September 08, 2023
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
This annotation update included:
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| III | SUT035/YNCC0015W | New ncRNA chrIII:205766..205942 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | YDR278C | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| IV | SUT053/YNCD0033W | New ncRNA chrIV:506334..507774 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | SUT468/YNCD0034C | New ncRNA chrIV:506546..507450 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT532/YNCG0047C | New ncRNA chrVII:17213..17709 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT125/YNCG0048W | New ncRNA chrVII:650855..651159 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349 |
| VII | SUT126/YNCG0049W | New ncRNA chrVII:660087..661399 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| XII | FPS1/YLL043W | New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA | Cartwright SP, et al. (2017) PMID:28279185 |
| XIV | ACC1/YNR016C | New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA | Blank HM, et al. (2017) PMID:28057705 |
| XIV | HOL1/YNR055C | New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA | Vindu A, et al. (2021) PMID:34375581 |
| XV | YOL013W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| XVI | SUT390/YNCP0025W | New ncRNA chrXVI:52977..53465 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | SUT418/YNCP0026W | New ncRNA chrXVI:588998..589830 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | YPR108W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
Various sequence and annotation files are available on SGD’s Downloads site.
Categories: Data updates