New & Noteworthy
Reference Genome Annotation Update R64.5
June 19, 2024
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.5.1, dated 2024-05-29. Note that the underlying genome sequence itself was not altered. The chromosome sequences remain stable and unchanged.
R64.5 Annotation update summary
This annotation update included (details in table below):
- new ORFs: YDL204W-A, YFR035W-A, YGR016C-A, YMR106W-A, YNL040C-A, YNL155C-A
- new uORFs for existing ORFs: ATG12/YBR217W, ATG19/YOL082W, ATG5/YPL149W, ATG13/YPR185W
- move start downstream: EFM4/YIL064W
- ORF upgraded from Dubious to Verified: YIL059C
R64.5 Annotation update details
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| II | ATG12/YBR217W | New uORF chrII:657824..657835, partially overlaps CDS | Yang Y, et al. (2023) PMID:35363116 |
| IV | YDL204W-A | New ORF chrIV:94133..94285 | Wacholder A, et al. (2023) PMID:37164009 |
| VI | YFR035W-A | New ORF chrVI:226260..226550 | Wacholder A and Carvunis AR (2023) PMID:38048358 |
| VII | YGR016C-A | New ORF chrVII:523353..523246 | Wacholder A, et al. (2023) PMID:37164009, Chang S, et al. (2023) PMID:37927910 |
| IX | EFM4/YIL064W | Move start 84 nucleotides downstream, new coordinates chrIX:242027..242716 | Hamey JJ, et al. (2024)PMID:38199565 |
| IX | YIL059C | Change ORF qualifier from Dubious to Verified because stable translation product detected | Wacholder A and Carvunis AR (2023) PMID:38048358 |
| XIII | YMR106W-A | New ORF chrXIII:480924..481187 | Wacholder A and Carvunis AR (2023) PMID:38048358 |
| XIV | YNL040C-A | New ORF chrXIV:552558..552478 | Wacholder A, et al. (2023) PMID:37164009 |
| XIV | YNL155C-A | New ORF chrXIV:342135..341911 | Wacholder A and Carvunis AR (2023) PMID:38048358 |
| XV | ATG19/YOL082W | New uORF chrXV:168632..168679 | Yang Y, et al. (2023) PMID:35363116 |
| XVI | ATG5/YPL149W | 4 new uORFs: chrXVI:271236..271277, chrXVI:271252..271302, chrXVI:271299..271307, chrXVI:271302..271307 | Yang Y, et al. (2023) PMID:35363116 |
| XVI | ATG13/YPR185W | New uORF chrXVI:907211..907351, partially overlaps CDS | Yang Y, et al. (2023) PMID:35363116 |
Categories: Data updates
Changes to Saccharomyces cerevisiae GFF3 file
March 01, 2024
The saccharomyces_cerevisiae.gff contains sequence features of Saccharomyces cerevisiae and related information such as Locus descriptions and GO annotations. It is fully compatible with Generic Feature Format Version 3. It is updated weekly.
After November 2020, SGD updated the transcripts in the GFF file to reflect the experimentally determined transcripts (Pelechano et al. 2013, Ng et al. 2020), when possible. The longest transcripts were determined for two different growth media – galactose and dextrose. When available, experimentally determined transcripts for one or both conditions were added for a gene. When this data was absent, transcripts matching the start and stop coordinates of an open reading frame (ORF) were used.
Beginning in February 2024, SGD increased the start and stop coordinates of genes to encompass the start and stop coordinates of the longest experimentally determined transcripts, regardless of condition. This change was made in order to comply with JBrowse 2, a newer and more extensible genome browser, which requires that parent features in GFF files (genes) are larger than child features (mRNA, CDS, etc) (Diesh et al., 2023).
This is a standard format used by many groups. SGD uses the GFF file to load the reference tracks in SGD’s genome browser resource.
Categories: Announcements, Data updates
Tags: biology, blog, genetics, news, Saccharomyces cerevisiae
Allele SGDIDs added to YeastMine
September 28, 2023
YeastMine is SGD’s data warehouse, powered by InterMine. We have so many templates (i.e., pre-defined queries) that provide access to so many different kinds of data!
A big area of focus for SGD and the yeast community is alleles. Alleles are different versions of genes that vary in DNA and sometimes protein sequence. Did you know that you can easily and quickly get all curated yeast allele data directly from YeastMine?
From the YeastMine home page, click ‘Templates‘ at top left. From there, filter for ‘allele’.
The Genes -> Alleles template returns data for one gene or a list of genes or the entire genome! Data include standard and systematic names for genes, gene name descriptions, allele names and descriptions, allele types, aliases, and references. SGDIDs for genes are included, and now SGDIDs for the alleles have been added. Previously, this query returned all of these data without the SGDIDs for the alleles. Based on user feedback, we have now made these allele SGDIDs available, so that they can be used to identify and distinguish different alleles. Enjoy!
There are thousands of alleles in SGD! Give the YeastMine Genes -> Alleles template a whirl! Get all the alleles for your favorite gene or list of genes.
For help using YeastMine, please see the SGD Help Pages and YouTube Channel.
Categories: Data updates, Website changes
Downloads files added to YeastMine
September 20, 2023
Back in the day, SGD maintained an FTP site to distribute data in various files. More recently, you have found these files in the SGD Downloads site. We have now moved these files to YeastMine:
From the YeastMine homepage, click Templates at top left. In the Filter, select ‘Downloads’ to constrain the list of templates.
The following templates are listed under Downloads:
• Deleted Merged Features: Retrieve all deleted and merged features.
• Retrieve Functional Complementation for genes: For gene(s), retrieve information about cross-species functional complementation between yeast and another species.
• Retrieve GO Terms: Retrieve GO Terms, including name, ID, namespace, and definition.
• Retrieve SGD chromosomal Features: Retrieve genes and other chromosomal features, including IDs, coordinates, and descriptions.
• Retrieve all cross-references for all genes: Retrieve IDs for yeast gene and gene products in other databases.
• Retrieve all domains of all genes: Retrieve Proteins/Genes that have a given domain.
• Retrieve all interactions for all genes: Retrieve physical and genetic interactions for all genes.
• Retrieve all pathways for all genes: Retrieve all metabolic pathways for all genes.
• Retrieve protein properties of all proteins of ORFs: Retrieve protein properties, including pI, molecular weight, N-terminal and C-terminal sequences, codon bias, etc. of all proteins.
For help using YeastMine, please see the SGD Help Pages and YouTube Channel.
Categories: Data updates, Tutorial, Website changes
Reference Genome Annotation Update R64.4
September 08, 2023
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
This annotation update included:
- new uORFs for 3 ORFs:
- 8 new ncRNAs:
- 3 ORFs demoted from ‘Uncharacterized’ to ‘Dubious’ based on request from NCBI because they overlap tRNAs:
R64.4 Annotation update details
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| III | SUT035/YNCC0015W | New ncRNA chrIII:205766..205942 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | YDR278C | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| IV | SUT053/YNCD0033W | New ncRNA chrIV:506334..507774 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | SUT468/YNCD0034C | New ncRNA chrIV:506546..507450 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT532/YNCG0047C | New ncRNA chrVII:17213..17709 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT125/YNCG0048W | New ncRNA chrVII:650855..651159 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349 |
| VII | SUT126/YNCG0049W | New ncRNA chrVII:660087..661399 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| XII | FPS1/YLL043W | New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA | Cartwright SP, et al. (2017) PMID:28279185 |
| XIV | ACC1/YNR016C | New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA | Blank HM, et al. (2017) PMID:28057705 |
| XIV | HOL1/YNR055C | New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA | Vindu A, et al. (2021) PMID:34375581 |
| XV | YOL013W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| XVI | SUT390/YNCP0025W | New ncRNA chrXVI:52977..53465 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | SUT418/YNCP0026W | New ncRNA chrXVI:588998..589830 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | YPR108W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
Various sequence and annotation files are available on SGD’s Downloads site.
Categories: Data updates
Tags: genome annotation update, Saccharomyces cerevisiae
Predicted 3D Structures of Yeast Complexes
January 20, 2022
In an exciting new paper, Humphreys et al. describe the use of deep-learning-based algorithms to predict structures of not only single proteins, but assemblies of proteins. The team used rapid RoseTTAFold combined with the more accurate AlphaFold to build structural models for 106 previously unidentified protein assemblies and 806 complexes that had not been structurally characterized. The complexes have up to five subunits and are involved in numerous critical roles in cell biology.
Go look for your own proteins of interest at the ModelArchive and search in the Home page. Also find the link on the resources section of the SGD Interaction and Protein pages.
Categories: Announcements, Data updates, Paper of the Week
Tags: protein complex, Saccharomyces cerevisiae, yeast protein assembly
Protein Complex Page Updates
December 01, 2021
SGD has updated our protein complex pages to have the same format as gene pages, with tabs across the top for each category of information, including a Summary page, a new Gene Ontology page, and a new Literature page for each complex. Just as we do for all of your favorite genes, Gene Ontology and Literature curation for complexes will be ongoing.
If you have any questions or feedback about the updates to our complex pages, please do not hesitate to contact us at any time.
Categories: Announcements, Data updates, Website changes
Tags: protein complex, Saccharomyces cerevisiae
New links to AlphaFold 3D Predicted Protein Structure Database
November 09, 2021
Would you like to see the shape of your protein?
SGD now contains links to AlphaFold in the Resources section of the Summary, Protein and Homology pages for every gene.
- The links through SGD give quick access to EMBL–European Bioinformatics Institute‘s new, highly accurate tool for predicting protein structure.
- Given a peptide sequence for an uncharacterized protein, AlphaFold will model predicted domains and provide relative confidence levels for each portion of the prediction.
- The predicted domains can then be compared to known protein structures (using a tool such as PDBeFold to seek matches to characterized protein families).
- Whether or not a family is identified, the comparison will yield clues to protein function to help design the next experiments.
Categories: Data updates
Updates to legacy gene names
November 05, 2021
SGD has long been the keeper of the official Saccharomyces cerevisiae gene nomenclature. Robert Mortimer handed over this responsibility to SGD in 1993 after maintaining the yeast genetic map and gene nomenclature for 30 years.
The accepted format for gene names in S. cerevisiae comprises three uppercase letters followed by a number. The letters typically signify a phrase (referred to as the “Name Description” in SGD) that provides information about a function, mutant phenotype, or process related to that gene, for example “ADE” for “ADEnine biosynthesis” or “CDC” for “Cell Division Cycle”. Gene names for many types of chromosomal features follow this basic format regardless of the type of feature named, whether an ORF, a tRNA, another type of non-coding RNA, an ARS, or a genetic locus. Some S. cerevisiae gene names that pre-date the current nomenclature standards do not conform to this format, such as MRLP38, RPL1A, and OM45.
A few historical gene names predate both the nomenclature standards and the database, and were less computer-friendly than more recent gene names, due to the presence of punctuation. SGD recently updated these gene names to be consistent with current standards and to be more software-friendly by removing punctuation. The old names for these four genes have been retained as aliases.
| ORF | Old gene name | New gene name |
|---|---|---|
| YGL234W | ADE5,7 | ADE57 |
| YER069W | ARG5,6 | ARG56 |
| YBR208C | DUR1,2 | DUR12 |
| YIL154C | IMP2′ | IMP21 |
Categories: Announcements, Data updates
Tags: gene nomenclature
Reference Genome Annotation Update R64.3
August 03, 2021
The S. cerevisiae strain S288C reference genome annotation was updated in its first major update since 2014. The new genome annotation is release R64.3, which released on April 21, 2021. Note that the underlying sequence of 16 assembled nuclear chromosomes, plus the mitochondrial genome, remained unchanged in annotation release R64.3.1 (relative to genome sequence release R64.2.1).
This annotation update included:
- 7 new ORFs: OTO1/YGR227C-A, YHR052C-B, YHR054C-B, YJR107C-A, YKL104W-A, YLR379W-A, YMR008C-A
- 5 new ncRNAs: GAL10-ncRNA, TBRT/XUT_2F-154, SUT169, PHO84 lncRNA, GAL4 lncRNA
- 2 new uORFs for ROK1/YGL171W
- 1 new recombination enhancer: RE
- 1 new LTR: YELWdelta27
- 3 ORFs with shifted translation starts: HPA3/YEL066W, YJR012C, LTO1/YNL260C
- 1 ORF with shifted translation stop plus new intron: LDO45/YMR147W
- Changed feature_type (and SO_term) for non-transcribed spacers: NTS1-2, NTS2-1, NTS2-2
- New systematic nomenclature system for entire annotated complement of ncRNAs
R64.3 Annotation update details
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| II | YNCB0008W aka GAL10-ncRNA | New ncRNA antisense to GAL10coordinates 276805..280645 | Houseley et al 2008 PMID:19061643,Pinskaya et al 2009 PMID:19407817, Geisler et al 2012 PMID:22226051 |
| II | YNCB0014W aka TBRT/XUT_2F-154 | New ncRNA antisense to TAT1coordinates 376610..378633 | Awasthi et al 2020 PMID:32081726 |
| III | RE/RE301 | New recombination enhancercoordinates 29108..29809 | Wu and Haber 1996 PMID:8861911 |
| V | YELWdelta27 | New Ty1 LTRcoordinates 449274..449626 | Nene et al 2018 PMID:29320491 |
| V | HPA3/YEL066W | Moved translation start to Met19old coordinates: 26667..27206new coordinates: 26721..27206 | Sampath et al 2013 PMID:23775086 |
| VII | OTO1/YGR227C-A | New ORFcoordinates 949052..949225 Crick | Makanae et al 2015 PMID:25781884 |
| VII | ROK1/YGL171W | Two new uORFscoordinates uORF1: 182286..182407coordinates uORF2: 182291..182329 | Jeon and Kim 2010 PMID:20969870 |
| VIII | YHR052C-B | New ORFcoordinates: 212519..212692 Crick | He et al 2018 PMID:29897761 |
| VIII | YHR054C-B | New ORFcoordinates: 214517..214690 Crick | He et al 2018 PMID:29897761 |
| VIII | SUT169/YNCH0011W | New ncRNAcoordinates 378254..379237 | Xu et al 2009 PMID:19169243,Geisler et al 2012 PMID:22226051, Huber et al 2016 PMID:27292640, Bunina et al 2017 PMID:28977638 |
| X | YJR012C | Moved start to Met76old coordinates: 459795..460418 Cricknew coordinates: 459795..460193 Crick | Sadhu et al 2018 PMID:29632376 |
| X | YJR107C-A | New ORFcoordinates 628457..628693 Crick | Yagoub et al 2015 PMID:26554900, He et al 2018 PMID:29897761 |
| XI | YKL104W-A | New ORFcoordinates 245032..245286 | He et al 2018 PMID:29897761 |
| XII | YLR379W-A | New ORFcoordinates: 877444..877716 | Internal reanalysis of results from Song et al 2015 to find and annotate missing S288C ORFs PMID:25781462 |
| XII | NTS1-2, NTS2-1, NTS2-2 | Change feature_type/SO_term from SO:0001637 rRNA_gene to SO:0000183 non_transcribed_region | |
| XIII | LDO45/YMR147W | Shift stop to be same as LDO16/YMR148W, add intronold coordinates 559199..559870new coordinates 559199..559780, 560156..560812 | Eisenberg-Bord et al 2018 PMID:29187527 |
| XIII | YMR008C-A | New ORFcoordinates 283081..283548 Crick | Internal reanalysis of results from Song et al 2015 to find and annotate missing S288C ORFs PMID:25781462 |
| XIII | YNCM0001W aka PHO84 lncRNA | New ncRNAcoordinates: 23564..26578 | Camblong et al 2007 PMID:18022365 |
| XIV | LTO1/YNL260C | Move start to Met37old coordinates: 156859..157455 Cricknew coordinates: 156859..157347 Crick | Paul et al 2015 PMID:26182403 |
| XVI | YNCP0002W aka GAL4 lncRNA | New ncRNAcoordinates: 79562..82648 | Geisler et al 2012 PMID:22226051 |
New systematic nomenclature system for noncoding RNA genes
| Chr | Systematic_name | Gene_name | Alias | Feature_type | Coordinates | Strand |
|---|---|---|---|---|---|---|
| I | YNCA0001W | HRA1 | ncRNA gene | 99305..99868 | + | |
| I | YNCA0002W | TRN1 | tP(UGG)A, tRNA-Pro | tRNA gene | 139152..139254 | + |
| I | YNCA0003W | SNR18 | snR18 | snoRNA gene | 142367..142468 | + |
| I | YNCA0004W | TGA1 | tA(UGC)A, tRNA-Ala | tRNA gene | 166267..166339 | + |
| I | YNCA0005W | SUP56 | tL(CAA)A, tRNA-Leu | tRNA gene | 181141..181254 | + |
| I | YNCA0006C | tS(AGA)A, tRNA-Ser | tRNA gene | 182522..182603 | – | |
| II | YNCB0001W | tL(UAA)B1, tRNA-Leu | tRNA gene | 9583..9666 | + | |
| II | YNCB0002W | tF(GAA)B, tRNA-Phe | tRNA gene | 36398..36488 | + | |
| II | YNCB0003W | SNR56 | snR56 | snoRNA gene | 88190..88277 | + |
| II | YNCB0004W | tI(AAU)B, tRNA-Ile | tRNA gene | 197494..197567 | + | |
| II | YNCB0005C | tG(GCC)B, tRNA-Gly | tRNA gene | 197629..197699 | – | |
| II | YNCB0006W | tS(AGA)B, tRNA-Ser | tRNA gene | 227075..227156 | + | |
| II | YNCB0007W | tT(AGU)B, tRNA-Thr | tRNA gene | 266378..266450 | + | |
| II | YNCB0008W | GAL10-ncRNA | ncRNA gene | 276805..280645 | + | |
| II | YNCB0009C | SNR161 | snR161 | snoRNA gene | 307185..307345 | – |
| II | YNCB0010W | TLC1 | telomerase RNA gene | 307587..308887 | + | |
| II | YNCB0011C | tV(UAC)B, tRNA-Val | tRNA gene | 326792..326865 | – | |
| II | YNCB0012W | tL(UAA)B2, tRNA-Leu | tRNA gene | 347603..347686 | + | |
| II | YNCB0013W | tQ(UUG)B, tRNA-Gln | tRNA gene | 350827..350898 | + | |
| II | YNCB0014W | TBRT | XUT_2F-154 | ncRNA gene | 376610..378633 | + |
| II | YNCB0015W | tR(UCU)B, tRNA-Arg | tRNA gene | 405878..405949 | + | |
| II | YNCB0016W | tD(GUC)B, tRNA-Asp | tRNA gene | 405960..406031 | + | |
| II | YNCB0017C | tC(GCA)B, tRNA-Cys | tRNA gene | 643007..643078 | – | |
| II | YNCB0018W | tE(UUC)B, tRNA-Glu | tRNA gene | 645167..645238 | + | |
| II | YNCB0019C | LSR1 | snRNA gene | 680688..681862 | – | |
| III | YNCC0001C | tE(UUC)C, tRNA-Glu | tRNA gene | 82462..82533 | – | |
| III | YNCC0002W | SUP53 | tL(CAA)C, tRNA-Leu | tRNA gene | 90859..90972 | + |
| III | YNCC0003C | SNR43 | snR43 | snoRNA gene | 107504..107712 | – |
| III | YNCC0004C | SUF2 | tP(AGG)C, tRNA-Pro | tRNA gene | 123577..123648 | – |
| III | YNCC0005W | tN(GUU)C, tRNA-Asn | tRNA gene | 127716..127789 | + | |
| III | YNCC0006C | SNR33 | snR33 | snoRNA gene | 142364..142546 | – |
| III | YNCC0007C | SUF16 | tG(GCC)C, tRNA-Gly | tRNA gene | 142701..142771 | – |
| III | YNCC0008W | tM(CAU)C, tRNA-Met | tRNA gene | 149920..149991 | + | |
| III | YNCC0009C | tK(CUU)C, tRNA-Lys | tRNA gene | 151284..151356 | – | |
| III | YNCC0010C | tQ(UUG)C, tRNA-Gln | tRNA gene | 168301..168372 | – | |
| III | YNCC0011W | SNR65 | snR65 | snoRNA gene | 177183..177282 | + |
| III | YNCC0012C | SNR189 | snR189 | snoRNA gene | 178610..178798 | – |
| III | YNCC0013W | SUP61 | tS(CGA)C, tRNA-Ser | tRNA gene | 227942..228042 | + |
| III | YNCC0014W | tT(AGU)C, tRNA-Thr | tRNA gene | 295484..295556 | + | |
| IV | YNCD0001W | tG(GCC)D1, tRNA-Gly | tRNA gene | 83548..83618 | + | |
| IV | YNCD0002C | SNR63 | snR63 | snoRNA gene | 323217..323471 | – |
| IV | YNCD0003W | tK(UUU)D, tRNA-Lys | tRNA gene | 359577..359672 | + | |
| IV | YNCD0004W | tA(AGC)D, tRNA-Ala | tRNA gene | 410379..410451 | + | |
| IV | YNCD0005C | tT(AGU)D, tRNA-Thr | tRNA gene | 434264..434336 | – | |
| IV | YNCD0006W | tS(AGA)D1, tRNA-Ser | tRNA gene | 437772..437853 | + | |
| IV | YNCD0007C | tV(UAC)D, tRNA-Val | tRNA gene | 488797..488870 | – | |
| IV | YNCD0008W | tL(UAA)D, tRNA-Leu | tRNA gene | 519743..519826 | + | |
| IV | YNCD0009W | tQ(UUG)D1, tRNA-Gln | tRNA gene | 520972..521043 | + | |
| IV | YNCD0010C | SNR47 | snR47 | snoRNA gene | 541602..541700 | – |
| IV | YNCD0011W | tR(UCU)D, tRNA-Arg | tRNA gene | 568882..568953 | + | |
| IV | YNCD0012W | tD(GUC)D, tRNA-Asp | tRNA gene | 568964..569035 | + | |
| IV | YNCD0013C | tR(ACG)D, tRNA-Arg | tRNA gene | 619969..620041 | – | |
| IV | YNCD0014C | tQ(UUG)D2, tRNA-Gln | tRNA gene | 645153..645224 | – | |
| IV | YNCD0015C | tI(AAU)D, tRNA-Ile | tRNA gene | 668007..668080 | – | |
| IV | YNCD0016C | tQ(UUG)D3, tRNA-Gln | tRNA gene | 802731..802802 | – | |
| IV | YNCD0017W | tI(UAU)D, tRNA-Ile | tRNA gene | 884361..884493 | + | |
| IV | YNCD0018W | SUP2 | tY(GUA)D, tRNA-Tyr | tRNA gene | 946312..946400 | + |
| IV | YNCD0019C | tS(AGA)D2, tRNA-Ser | tRNA gene | 980974..981055 | – | |
| IV | YNCD0020W | tG(GCC)D2, tRNA-Gly | tRNA gene | 992832..992902 | + | |
| IV | YNCD0021C | tE(CUC)D, tRNA-Glu | tRNA gene | 1017207..1017278 | – | |
| IV | YNCD0022C | tV(CAC)D, tRNA-Val | tRNA gene | 1075472..1075544 | – | |
| IV | YNCD0023C | tF(GAA)D, tRNA-Phe | tRNA gene | 1095370..1095461 | – | |
| IV | YNCD0024C | tX(XXX)D | tRNA gene | 1150842..1150941 | – | |
| IV | YNCD0025W | EMT1 | tM(CAU)D, tRNA-Met | tRNA gene | 1175829..1175901 | + |
| IV | YNCD0026W | tK(CUU)D1, tRNA-Lys | tRNA gene | 1201750..1201822 | + | |
| IV | YNCD0027C | SUF3 | tG(CCC)D, tRNA-Gly | tRNA gene | 1257008..1257079 | – |
| IV | YNCD0028W | tS(AGA)D3, tRNA-Ser | tRNA gene | 1305630..1305712 | + | |
| IV | YNCD0029C | tK(CUU)D2, tRNA-Lys | tRNA gene | 1352466..1352538 | – | |
| IV | YNCD0030W | SNR13 | snR13 | snoRNA gene | 1402919..1403042 | + |
| IV | YNCD0031C | tL(CAA)D, tRNA-Leu | tRNA gene | 1461715..1461829 | – | |
| IV | YNCD0032C | SNR84 | snR84 | snoRNA gene | 1492477..1493026 | – |
| V | YNCE0001C | SNR80 | snR80 | snoRNA gene | 52150..52320 | – |
| V | YNCE0002W | SNR67 | snR67 | snoRNA gene | 61352..61433 | + |
| V | YNCE0003W | SNR53 | snR53 | snoRNA gene | 61699..61789 | + |
| V | YNCE0004C | tG(GCC)E, tRNA-Gly | tRNA gene | 61890..61960 | – | |
| V | YNCE0005W | tS(AGA)E, tRNA-Ser | tRNA gene | 86604..86685 | + | |
| V | YNCE0006W | IMT4 | tM(CAU)E, tRNA-Met | tRNA gene | 100133..100204 | + |
| V | YNCE0007C | RPR1 | ncRNA gene | 117667..118035 | – | |
| V | YNCE0008C | tQ(UUG)E2, tRNA-Gln | tRNA gene | 131082..131153 | – | |
| V | YNCE0009C | tK(CUU)E1, tRNA-Lys | tRNA gene | 135425..135497 | – | |
| V | YNCE0010W | tR(UCU)E, tRNA-Arg | tRNA gene | 138666..138737 | + | |
| V | YNCE0011C | SNR14 | snR14 | snRNA gene | 167427..167586 | – |
| V | YNCE0012W | tE(UUC)E1, tRNA-Glu | tRNA gene | 177099..177170 | + | |
| V | YNCE0013W | tH(GUG)E1, tRNA-His | tRNA gene | 207357..207428 | + | |
| V | YNCE0014W | tQ(UUG)E1, tRNA-Gln | tRNA gene | 250286..250357 | + | |
| V | YNCE0015C | SUP19 | tS(UGA)E, tRNA-Ser | tRNA gene | 288443..288524 | – |
| V | YNCE0016C | tA(UGC)E, tRNA-Ala | tRNA gene | 312023..312095 | – | |
| V | YNCE0017W | SRG1 | ncRNA gene | 322212..322762 | + | |
| V | YNCE0018W | tE(UUC)E2, tRNA-Glu | tRNA gene | 354934..355005 | + | |
| V | YNCE0019W | SNR4 | snR4 | snoRNA gene | 424698..424883 | + |
| V | YNCE0020C | SNR52 | snR52 | snoRNA gene | 431129..431220 | – |
| V | YNCE0021C | tH(GUG)E2, tRNA-His | tRNA gene | 434541..434612 | – | |
| V | YNCE0022C | tK(CUU)E2, tRNA-Lys | tRNA gene | 435752..435824 | – | |
| V | YNCE0023W | tV(AAC)E1, tRNA-Val | tRNA gene | 438700..438773 | + | |
| V | YNCE0024W | SCR1 | ncRNA gene | 441987..442508 | + | |
| V | YNCE0025C | tI(AAU)E1, tRNA-Ile | tRNA gene | 443202..443275 | – | |
| V | YNCE0026W | tV(AAC)E2, tRNA-Val | tRNA gene | 469457..469530 | + | |
| V | YNCE0027C | tE(UUC)E3, tRNA-Glu | tRNA gene | 487331..487402 | – | |
| V | YNCE0028C | tR(ACG)E, tRNA-Arg | tRNA gene | 492352..492424 | – | |
| V | YNCE0029C | tI(AAU)E2, tRNA-Ile | tRNA gene | 551285..551358 | – | |
| VI | YNCF0001C | RUF21 | ncRNA gene | 57815..58521 | – | |
| VI | YNCF0002W | SUF9 | tP(UGG)F, tRNA-Pro | tRNA gene | 101376..101478 | + |
| VI | YNCF0003C | RUF20 | ncRNA gene | 131061..131503 | – | |
| VI | YNCF0004C | tN(GUU)F, tRNA-Asn | tRNA gene | 137486..137559 | – | |
| VI | YNCF0005C | tF(GAA)F, tRNA-Phe | tRNA gene | 157916..158007 | – | |
| VI | YNCF0006W | SUF20 | tG(GCC)F1, tRNA-Gly | tRNA gene | 162228..162298 | + |
| VI | YNCF0007W | SUP11 | tY(GUA)F1, tRNA-Tyr | tRNA gene | 167437..167525 | + |
| VI | YNCF0008C | tG(GCC)F2, tRNA-Gly | tRNA gene | 180974..181044 | – | |
| VI | YNCF0009C | tS(GCU)F, tRNA-Ser | tRNA gene | 191513..191613 | – | |
| VI | YNCF0010C | RUF22 | ncRNA gene | 199299..199813 | – | |
| VI | YNCF0011C | tA(AGC)F, tRNA-Ala | tRNA gene | 204924..204996 | – | |
| VI | YNCF0012C | SUP6 | tY(GUA)F2, tRNA-Tyr | tRNA gene | 210619..210707 | – |
| VI | YNCF0013W | RUF23 | ncRNA gene | 221714..221967 | + | |
| VI | YNCF0014C | tK(CUU)F, tRNA-Lys | tRNA gene | 226688..226760 | – | |
| VII | YNCG0001C | RME3 | ncRNA gene | 33109..35013 | – | |
| VII | YNCG0002C | tV(AAC)G3, tRNA-Val | tRNA gene | 73829..73902 | – | |
| VII | YNCG0003C | tH(GUG)G1, tRNA-His | tRNA gene | 110625..110696 | – | |
| VII | YNCG0004W | tK(UUU)G1, tRNA-Lys | tRNA gene | 115488..115583 | + | |
| VII | YNCG0005W | tK(CUU)G1, tRNA-Lys | tRNA gene | 122269..122341 | + | |
| VII | YNCG0006C | RME2 | ncRNA gene | 141898..144120 | – | |
| VII | YNCG0007C | tK(CUU)G2, tRNA-Lys | tRNA gene | 185714..185786 | – | |
| VII | YNCG0008W | tL(CAA)G1, tRNA-Leu | tRNA gene | 205521..205634 | + | |
| VII | YNCG0009C | tW(CCA)G1, tRNA-Trp | tRNA gene | 287350..287455 | – | |
| VII | YNCG0010W | SNR82 | snR82 | snoRNA gene | 316788..317055 | + |
| VII | YNCG0011W | tH(GUG)G2, tRNA-His | tRNA gene | 319781..319852 | + | |
| VII | YNCG0012W | SOE1 | tE(UUC)G1, tRNA-Glu | tRNA gene | 328583..328654 | + |
| VII | YNCG0013W | SNR10 | snR10 | snoRNA gene | 345986..346230 | + |
| VII | YNCG0014C | SNR39 | snR39 | snoRNA gene | 365163..365251 | – |
| VII | YNCG0015C | SNR39B | snR39B | snoRNA gene | 366374..366469 | – |
| VII | YNCG0016C | tE(UUC)G2, tRNA-Glu | tRNA gene | 401527..401598 | – | |
| VII | YNCG0017W | tR(UCU)G1, tRNA-Arg | tRNA gene | 405470..405541 | + | |
| VII | YNCG0018C | tV(AAC)G1, tRNA-Val | tRNA gene | 412294..412367 | – | |
| VII | YNCG0019W | SUP54 | tL(CAA)G2, tRNA-Leu | tRNA gene | 423092..423205 | + |
| VII | YNCG0020C | tF(GAA)G, tRNA-Phe | tRNA gene | 440716..440807 | – | |
| VII | YNCG0021W | tD(GUC)G1, tRNA-Asp | tRNA gene | 531610..531681 | + | |
| VII | YNCG0022W | tE(UUC)G3, tRNA-Glu | tRNA gene | 541850..541921 | + | |
| VII | YNCG0023C | tD(GUC)G2, tRNA-Asp | tRNA gene | 544577..544648 | – | |
| VII | YNCG0024W | SNR46 | snR46 | snoRNA gene | 545370..545566 | + |
| VII | YNCG0025C | tS(AGA)G, tRNA-Ser | tRNA gene | 561662..561743 | – | |
| VII | YNCG0026W | SNR48 | snR48 | snoRNA gene | 609584..609696 | + |
| VII | YNCG0027W | tT(UGU)G1, tRNA-Thr | tRNA gene | 661749..661820 | + | |
| VII | YNCG0028W | tL(GAG)G, tRNA-Leu | tRNA gene | 700675..700756 | + | |
| VII | YNCG0029C | tK(UUU)G2, tRNA-Lys | tRNA gene | 700953..701048 | – | |
| VII | YNCG0030C | tC(GCA)G, tRNA-Cys | tRNA gene | 707108..707179 | – | |
| VII | YNCG0031W | tN(GUU)G, tRNA-Asn | tRNA gene | 731137..731210 | + | |
| VII | YNCG0032W | tR(UCU)G3, tRNA-Arg | tRNA gene | 736340..736411 | + | |
| VII | YNCG0033W | tI(AAU)G, tRNA-Ile | tRNA gene | 739122..739195 | + | |
| VII | YNCG0034W | tA(AGC)G, tRNA-Ala | tRNA gene | 774349..774421 | + | |
| VII | YNCG0035W | SUF4 | tG(UCC)G, tRNA-Gly | tRNA gene | 779616..779687 | + |
| VII | YNCG0036W | tA(UGC)G, tRNA-Ala | tRNA gene | 794417..794489 | + | |
| VII | YNCG0037W | tV(AAC)G2, tRNA-Val | tRNA gene | 823482..823555 | + | |
| VII | YNCG0038C | tR(UCU)G2, tRNA-Arg | tRNA gene | 828723..828794 | – | |
| VII | YNCG0039W | tG(GCC)G1, tRNA-Gly | tRNA gene | 845649..845719 | + | |
| VII | YNCG0040C | tL(CAA)G3, tRNA-Leu | tRNA gene | 857378..857491 | – | |
| VII | YNCG0041W | tK(CUU)G3, tRNA-Lys | tRNA gene | 876394..876466 | + | |
| VII | YNCG0042C | tW(CCA)G2, tRNA-Trp | tRNA gene | 878710..878815 | – | |
| VII | YNCG0043C | tG(GCC)G2, tRNA-Gly | tRNA gene | 930953..931023 | – | |
| VII | YNCG0044C | SNR7-L | snR7-L | snRNA gene | 939459..939672 | – |
| VII | YNCG0045C | SNR7-S | snR7-S | snRNA gene | 939494..939672 | – |
| VII | YNCG0046W | tT(UGU)G2, tRNA-Thr | tRNA gene | 1004216..1004287 | + | |
| VIII | YNCH0001W | tH(GUG)H, tRNA-His | tRNA gene | 62755..62826 | + | |
| VIII | YNCH0002C | tV(AAC)H, tRNA-Val | tRNA gene | 85298..85371 | – | |
| VIII | YNCH0003C | tT(AGU)H, tRNA-Thr | tRNA gene | 116107..116179 | – | |
| VIII | YNCH0004C | tS(AGA)H, tRNA-Ser | tRNA gene | 133026..133107 | – | |
| VIII | YNCH0005W | tQ(UUG)H, tRNA-Gln | tRNA gene | 134321..134392 | + | |
| VIII | YNCH0006C | tA(AGC)H, tRNA-Ala | tRNA gene | 146242..146314 | – | |
| VIII | YNCH0007W | RUF5-1 | ncRNA gene | 212409..213118 | + | |
| VIII | YNCH0008W | RUF5-2 | ncRNA gene | 214407..215116 | + | |
| VIII | YNCH0009C | tF(GAA)H1, tRNA-Phe | tRNA gene | 237848..237939 | – | |
| VIII | YNCH0010C | tF(GAA)H2, tRNA-Phe | tRNA gene | 358478..358569 | – | |
| VIII | YNCH0011W | SUT169 | ncRNA gene | 378254..379237 | + | |
| VIII | YNCH0012W | SNR32 | snR32 | snoRNA gene | 381540..381727 | + |
| VIII | YNCH0013C | SUF8 | tP(UGG)H, tRNA-Pro | tRNA gene | 388893..388995 | – |
| VIII | YNCH0014W | SNR71 | snR71 | snoRNA gene | 411228..411317 | + |
| VIII | YNCH0015W | tT(UGU)H, tRNA-Thr | tRNA gene | 466990..467061 | + | |
| VIII | YNCH0016C | tV(CAC)H, tRNA-Val | tRNA gene | 475706..475778 | – | |
| IX | YNCI0001W | SNR68 | snR68 | snoRNA gene | 97111..97246 | + |
| IX | YNCI0002W | tT(AGU)I1, tRNA-Thr | tRNA gene | 175031..175103 | + | |
| IX | YNCI0003C | tI(AAU)I1, tRNA-Ile | tRNA gene | 183440..183513 | – | |
| IX | YNCI0004W | tE(CUC)I, tRNA-Glu | tRNA gene | 197592..197663 | + | |
| IX | YNCI0005W | tI(AAU)I2, tRNA-Ile | tRNA gene | 210665..210738 | + | |
| IX | YNCI0006W | SUP17 | tS(UGA)I, tRNA-Ser | tRNA gene | 248850..248931 | + |
| IX | YNCI0007C | tK(CUU)I, tRNA-Lys | tRNA gene | 300228..300300 | – | |
| IX | YNCI0008C | tD(GUC)I1, tRNA-Asp | tRNA gene | 324303..324374 | – | |
| IX | YNCI0009W | tT(AGU)I2, tRNA-Thr | tRNA gene | 325748..325820 | + | |
| IX | YNCI0010C | tD(GUC)I2, tRNA-Asp | tRNA gene | 336349..336420 | – | |
| IX | YNCI0011W | tE(UUC)I, tRNA-Glu | tRNA gene | 370417..370488 | + | |
| IX | YNCI0012 | ICR1 | ncRNA gene | 393884..397082 | – | |
| IX | YNCI0013W | PWR1 | ncRNA gene | 395999..396939 | + | |
| X | YNCJ0001C | tT(AGU)J, tRNA-Thr | tRNA gene | 59100..59172 | – | |
| X | YNCJ0002C | tE(UUC)J, tRNA-Glu | tRNA gene | 115939..116010 | – | |
| X | YNCJ0003C | SNR128 | snR128 | snoRNA gene | 139566..139691 | – |
| X | YNCJ0004C | SNR190 | snR190 | snoRNA gene | 139761..139950 | – |
| X | YNCJ0005C | tA(AGC)J, tRNA-Ala | tRNA gene | 197313..197385 | – | |
| X | YNCJ0006W | tD(GUC)J1, tRNA-Asp | tRNA gene | 204735..204806 | + | |
| X | YNCJ0007C | SNR37 | snR37 | snoRNA gene | 228094..228479 | – |
| X | YNCJ0008W | tR(ACG)J, tRNA-Arg | tRNA gene | 233939..234011 | + | |
| X | YNCJ0009C | SNR60 | snR60 | snoRNA gene | 349130..349233 | – |
| X | YNCJ0010W | SUP7 | tY(GUA)J1, tRNA-Tyr | tRNA gene | 354244..354332 | + |
| X | YNCJ0011W | tR(UCU)J1, tRNA-Arg | tRNA gene | 355374..355445 | + | |
| X | YNCJ0012W | tD(GUC)J2, tRNA-Asp | tRNA gene | 355456..355527 | + | |
| X | YNCJ0013C | tD(GUC)J3, tRNA-Asp | tRNA gene | 374424..374495 | – | |
| X | YNCJ0014C | tR(UCU)J2, tRNA-Arg | tRNA gene | 374506..374577 | – | |
| X | YNCJ0015W | tV(AAC)J, tRNA-Val | tRNA gene | 378360..378433 | + | |
| X | YNCJ0016C | EMT5 | tM(CAU)J1, tRNA-Met | tRNA gene | 391043..391115 | – |
| X | YNCJ0017C | tG(GCC)J1, tRNA-Gly | tRNA gene | 396726..396796 | – | |
| X | YNCJ0018W | tK(CUU)J, tRNA-Lys | tRNA gene | 414966..415038 | + | |
| X | YNCJ0019C | tW(CCA)J, tRNA-Trp | tRNA gene | 415931..416036 | – | |
| X | YNCJ0020W | EMT3 | tM(CAU)J2, tRNA-Met | tRNA gene | 422937..423009 | + |
| X | YNCJ0021C | SUP51 | tL(UAA)J, tRNA-Leu | tRNA gene | 424432..424515 | – |
| X | YNCJ0022C | IMT3 | tM(CAU)J3, tRNA-Met | tRNA gene | 517813..517884 | – |
| X | YNCJ0023C | tS(AGA)J, tRNA-Ser | tRNA gene | 524012..524093 | – | |
| X | YNCJ0024W | SUF23 | tG(GCC)J2, tRNA-Gly | tRNA gene | 531828..531898 | + |
| X | YNCJ0025W | HSX1 | tR(CCU)J, tRNA-Arg | tRNA gene | 538555..538626 | + |
| X | YNCJ0026W | tD(GUC)J4, tRNA-Asp | tRNA gene | 541508..541579 | + | |
| X | YNCJ0027C | SUP4 | tY(GUA)J2, tRNA-Tyr | tRNA gene | 542956..543044 | – |
| X | YNCJ0028C | IRT1 | ncRNA gene | 605936..607424 | – | |
| X | YNCJ0029W | tL(UAG)J, tRNA-Leu | tRNA gene | 617919..618019 | + | |
| X | YNCJ0030W | SNR3 | snR3 | snoRNA gene | 663749..663942 | + |
| XI | YNCK0001W | SNR64 | snR64 | snoRNA gene | 38811..38911 | + |
| XI | YNCK0002C | TRT2 | tT(CGU)K, tRNA-Thr | tRNA gene | 46735..46806 | – |
| XI | YNCK0003W | tN(GUU)K, tRNA-Asn | tRNA gene | 74624..74697 | + | |
| XI | YNCK0004W | tL(UAA)K, tRNA-Leu | tRNA gene | 84208..84291 | + | |
| XI | YNCK0005C | tE(UUC)K, tRNA-Glu | tRNA gene | 141018..141089 | – | |
| XI | YNCK0006C | tR(UCU)K, tRNA-Arg | tRNA gene | 162487..162558 | – | |
| XI | YNCK0007W | tK(CUU)K, tRNA-Lys | tRNA gene | 202999..203071 | + | |
| XI | YNCK0008W | tA(AGC)K1, tRNA-Ala | tRNA gene | 219895..219967 | + | |
| XI | YNCK0009W | SNR38 | snR38 | snoRNA gene | 283185..283279 | + |
| XI | YNCK0010W | tW(CCA)K, tRNA-Trp | tRNA gene | 302918..303023 | + | |
| XI | YNCK0011C | tV(AAC)K1, tRNA-Val | tRNA gene | 308144..308217 | – | |
| XI | YNCK0012C | tH(GUG)K, tRNA-His | tRNA gene | 313401..313472 | – | |
| XI | YNCK0013W | SNR69 | snR69 | snoRNA gene | 364776..364876 | + |
| XI | YNCK0014W | tV(AAC)K2, tRNA-Val | tRNA gene | 379680..379753 | + | |
| XI | YNCK0015C | SNR87 | snR87 | snoRNA gene | 431030..431138 | – |
| XI | YNCK0016W | tL(CAA)K, tRNA-Leu | tRNA gene | 458557..458670 | + | |
| XI | YNCK0017W | tR(ACG)K, tRNA-Arg | tRNA gene | 490968..491040 | + | |
| XI | YNCK0018C | tD(GUC)K, tRNA-Asp | tRNA gene | 513332..513403 | – | |
| XI | YNCK0019W | tA(AGC)K2, tRNA-Ala | tRNA gene | 517988..518060 | + | |
| XI | YNCK0020C | SNR42 | snR42 | snoRNA gene | 559016..559366 | – |
| XI | YNCK0021W | tK(UUU)K, tRNA-Lys | tRNA gene | 578965..579060 | + | |
| XII | YNCL0001W | tP(UGG)L, tRNA-Pro | tRNA gene | 92548..92650 | + | |
| XII | YNCL0002C | tS(AGA)L, tRNA-Ser | tRNA gene | 167944..168025 | – | |
| XII | YNCL0003W | SNR30 | snR30 | snoRNA gene | 198784..199389 | + |
| XII | YNCL0004C | tA(UGC)L, tRNA-Ala | tRNA gene | 214883..214955 | – | |
| XII | YNCL0005C | SNR79 | snR79 | snoRNA gene | 348427..348510 | – |
| XII | YNCL0006W | SNR6 | snR6 | snRNA gene | 366235..366346 | + |
| XII | YNCL0007W | tR(ACG)L, tRNA-Arg | tRNA gene | 374355..374427 | + | |
| XII | YNCL0008W | tD(GUC)L1, tRNA-Asp | tRNA gene | 427132..427203 | + | |
| XII | YNCL0009C | tQ(UUG)L, tRNA-Gln | tRNA gene | 448650..448721 | – | |
| XII | YNCL0010C | RDN37-1 | rRNA gene | 451575..458432 | – | |
| XII | YNCL0011C | ETS2-1 | rRNA gene | 451575..451785 | – | |
| XII | YNCL0012C | RDN25-1 | rRNA gene | 451786..455181 | – | |
| XII | YNCL0013C | ITS2-1 | rRNA gene | 455182..455413 | – | |
| XII | YNCL0014C | RDN58-1 | rRNA gene | 455414..455571 | – | |
| XII | YNCL0015C | ITS1-1 | rRNA gene | 455572..455932 | – | |
| XII | YNCL0016C | RDN18-1 | rRNA gene | 455933..457732 | – | |
| XII | YNCL0017C | ETS1-1 | rRNA gene | 457733..458432 | – | |
| XII | YNCL0018W | RDN5-1 | rRNA gene | 459676..459796 | + | |
| XII | YNCL0019C | ETS2-2 | rRNA gene | 460712..460922 | – | |
| XII | YNCL0020C | RDN37-2 | rRNA gene | 460712..467569 | – | |
| XII | YNCL0021C | RDN25-2 | rRNA gene | 460923..464318 | – | |
| XII | YNCL0022C | ITS2-2 | rRNA gene | 464319..464550 | – | |
| XII | YNCL0023C | RDN58-2 | rRNA gene | 464551..464708 | – | |
| XII | YNCL0024C | ITS1-2 | rRNA gene | 464709..465069 | – | |
| XII | YNCL0025C | RDN18-2 | rRNA gene | 465070..466869 | – | |
| XII | YNCL0026C | ETS1-2 | rRNA gene | 466870..467569 | – | |
| XII | YNCL0027W | RDN5-2 | rRNA gene | 468813..468931 | + | |
| XII | YNCL0028W | RDN5-3 | rRNA gene | 472465..472583 | + | |
| XII | YNCL0029W | RDN5-4 | rRNA gene | 482045..482163 | + | |
| XII | YNCL0030W | RDN5-5 | rRNA gene | 485697..485815 | + | |
| XII | YNCL0031W | RDN5-6 | rRNA gene | 489349..489469 | + | |
| XII | YNCL0032C | tL(UAG)L1, tRNA-Leu | tRNA gene | 592519..592619 | – | |
| XII | YNCL0033C | tI(UAU)L, tRNA-Ile | tRNA gene | 605300..605432 | – | |
| XII | YNCL0034W | tL(CAA)L, tRNA-Leu | tRNA gene | 628383..628497 | + | |
| XII | YNCL0035C | tA(AGC)L, tRNA-Ala | tRNA gene | 656934..657006 | – | |
| XII | YNCL0036C | tV(AAC)L, tRNA-Val | tRNA gene | 687859..687932 | – | |
| XII | YNCL0037W | tL(UAG)L2, tRNA-Leu | tRNA gene | 732090..732190 | + | |
| XII | YNCL0038W | tI(AAU)L1, tRNA-Ile | tRNA gene | 734802..734875 | + | |
| XII | YNCL0039W | tX(XXX)L | tRNA gene | 784354..784453 | + | |
| XII | YNCL0040W | tD(GUC)L2, tRNA-Asp | tRNA gene | 793918..793989 | + | |
| XII | YNCL0041C | SNR61 | snR61 | snoRNA gene | 794486..794575 | – |
| XII | YNCL0042C | SNR55 | snR55 | snoRNA gene | 794697..794794 | – |
| XII | YNCL0043C | SNR57 | snR57 | snoRNA gene | 794937..795024 | – |
| XII | YNCL0044W | tE(UUC)L, tRNA-Glu | tRNA gene | 797178..797249 | + | |
| XII | YNCL0045W | TRR4 | tR(CCG)L, tRNA-Arg | tRNA gene | 818609..818680 | + |
| XII | YNCL0046W | SNR44 | snR44 | snoRNA gene | 856710..856920 | + |
| XII | YNCL0047W | tK(UUU)L, tRNA-Lys | tRNA gene | 875376..875471 | + | |
| XII | YNCL0048W | SNR34 | snR34 | snoRNA gene | 899180..899382 | + |
| XII | YNCL0049C | tL(UAA)L, tRNA-Leu | tRNA gene | 962972..963055 | – | |
| XII | YNCL0050C | tN(GUU)L, tRNA-Asn | tRNA gene | 975983..976056 | – | |
| XII | YNCL0051C | tI(AAU)L2, tRNA-Ile | tRNA gene | 1052071..1052144 | – | |
| XIII | YNCM0001W | PHO84 lncRNA | ncRNA gene | 23564..26578 | + | |
| XIII | YNCM0002C | SNR85 | snR85 | snoRNA gene | 67768..67938 | – |
| XIII | YNCM0003W | ZOD1 | ncRNA gene | 91970..92027 | + | |
| XIII | YNCM0004C | tR(UCU)M2, tRNA-Arg | tRNA gene | 131825..131896 | – | |
| XIII | YNCM0005C | SNR54 | snR54 | snoRNA gene | 163535..163620 | – |
| XIII | YNCM0006W | SUP5 | tY(GUA)M1, tRNA-Tyr | tRNA gene | 168795..168883 | + |
| XIII | YNCM0007C | tG(GCC)M, tRNA-Gly | tRNA gene | 183898..183968 | – | |
| XIII | YNCM0008C | SUF7 | tP(UGG)M, tRNA-Pro | tRNA gene | 196068..196170 | – |
| XIII | YNCM0009C | tS(AGA)M, tRNA-Ser | tRNA gene | 259158..259239 | – | |
| XIII | YNCM0010W | tE(UUC)M, tRNA-Glu | tRNA gene | 290801..290872 | + | |
| XIII | YNCM0011W | SNR78 | snR78 | snoRNA gene | 297278..297364 | + |
| XIII | YNCM0012W | SNR77 | snR77 | snoRNA gene | 297506..297593 | + |
| XIII | YNCM0013W | SNR76 | snR76 | snoRNA gene | 297725..297833 | + |
| XIII | YNCM0014W | SNR75 | snR75 | snoRNA gene | 297918..298006 | + |
| XIII | YNCM0015W | SNR74 | snR74 | snoRNA gene | 298138..298225 | + |
| XIII | YNCM0016W | SNR73 | snR73 | snoRNA gene | 298307..298412 | + |
| XIII | YNCM0017W | SNR72 | snR72 | snoRNA gene | 298554..298651 | + |
| XIII | YNCM0018C | tA(AGC)M1, tRNA-Ala | tRNA gene | 321147..321219 | – | |
| XIII | YNCM0019W | tF(GAA)M, tRNA-Phe | tRNA gene | 352280..352370 | + | |
| XIII | YNCM0020W | tH(GUG)M, tRNA-His | tRNA gene | 363064..363135 | + | |
| XIII | YNCM0021C | tV(AAC)M1, tRNA-Val | tRNA gene | 372445..372518 | – | |
| XIII | YNCM0022C | tW(CCA)M, tRNA-Trp | tRNA gene | 379303..379408 | – | |
| XIII | YNCM0023C | tV(AAC)M2, tRNA-Val | tRNA gene | 420588..420661 | – | |
| XIII | YNCM0024W | tD(GUC)M, tRNA-Asp | tRNA gene | 463554..463625 | + | |
| XIII | YNCM0025C | tK(CUU)M, tRNA-Lys | tRNA gene | 480621..480693 | – | |
| XIII | YNCM0026C | SNR24 | snR24 | snoRNA gene | 499984..500072 | – |
| XIII | YNCM0027W | tL(CAA)M, tRNA-Leu | tRNA gene | 504895..505008 | + | |
| XIII | YNCM0028C | EMT4 | tM(CAU)M, tRNA-Met | tRNA gene | 572883..572955 | – |
| XIII | YNCM0029C | tV(AAC)M3, tRNA-Val | tRNA gene | 586636..586709 | – | |
| XIII | YNCM0030W | SNR83 | snR83 | snoRNA gene | 626349..626654 | + |
| XIII | YNCM0031W | SNR11 | snR11 | snoRNA gene | 652275..652532 | + |
| XIII | YNCM0032C | RNA170 | ncRNA gene | 667288..667456 | – | |
| XIII | YNCM0033C | tR(UCU)M1, tRNA-Arg | tRNA gene | 747892..747963 | – | |
| XIII | YNCM0034C | SNR86 | snR86 | snoRNA gene | 762110..763113 | – |
| XIII | YNCM0035C | tA(AGC)M2, tRNA-Ala | tRNA gene | 768369..768441 | – | |
| XIII | YNCM0036C | CDC65 | tQ(CUG)M, tRNA-Gln | tRNA gene | 808246..808317 | – |
| XIII | YNCM0037W | SUP8 | tY(GUA)M2, tRNA-Tyr | tRNA gene | 837928..838016 | + |
| XIV | YNCN0001W | SNR40 | snR40 | snoRNA gene | 89210..89306 | + |
| XIV | YNCN0002C | SUF6 | tG(UCC)N, tRNA-Gly | tRNA gene | 96241..96312 | – |
| XIV | YNCN0003W | tN(GUU)N1, tRNA-Asn | tRNA gene | 102716..102789 | + | |
| XIV | YNCN0004W | tT(AGU)N1, tRNA-Thr | tRNA gene | 104805..104877 | + | |
| XIV | YNCN0005C | SNR19 | snR19 | snRNA gene | 230105..230672 | – |
| XIV | YNCN0006W | tF(GAA)N, tRNA-Phe | tRNA gene | 374869..374959 | + | |
| XIV | YNCN0007W | tL(CAA)N, tRNA-Leu | tRNA gene | 443006..443119 | + | |
| XIV | YNCN0008C | tD(GUC)N, tRNA-Asp | tRNA gene | 519099..519169 | – | |
| XIV | YNCN0009W | tP(UGG)N1, tRNA-Pro | tRNA gene | 547094..547196 | + | |
| XIV | YNCN0010C | tT(AGU)N2, tRNA-Thr | tRNA gene | 560693..560765 | – | |
| XIV | YNCN0011W | tP(UGG)N2, tRNA-Pro | tRNA gene | 568115..568217 | + | |
| XIV | YNCN0012C | tI(AAU)N1, tRNA-Ile | tRNA gene | 569867..569940 | – | |
| XIV | YNCN0013W | NME1 | snoRNA gene | 585587..585926 | + | |
| XIV | YNCN0014W | SNR66 | snR66 | snoRNA gene | 586090..586175 | + |
| XIV | YNCN0015W | tI(AAU)N2, tRNA-Ile | tRNA gene | 602312..602385 | + | |
| XIV | YNCN0016C | SUF10 | tP(AGG)N, tRNA-Pro | tRNA gene | 631846..631917 | – |
| XIV | YNCN0017W | tN(GUU)N2, tRNA-Asn | tRNA gene | 632599..632672 | + | |
| XIV | YNCN0018W | SNR49 | snR49 | snoRNA gene | 716120..716284 | + |
| XIV | YNCN0019C | SNR191 | snR191 | snoRNA gene | 721938..722211 | – |
| XIV | YNCN0020C | tL(UAA)N, tRNA-Leu | tRNA gene | 726134..726217 | – | |
| XV | YNCO0001C | SUF1 | tG(UCC)O, tRNA-Gly | tRNA gene | 110962..111033 | – |
| XV | YNCO0002W | tT(AGU)O1, tRNA-Thr | tRNA gene | 113802..113874 | + | |
| XV | YNCO0003C | SNR58 | snR58 | snoRNA gene | 136088..136183 | – |
| XV | YNCO0004C | tG(GCC)O1, tRNA-Gly | tRNA gene | 226611..226681 | – | |
| XV | YNCO0005W | tN(GUU)O1, tRNA-Asn | tRNA gene | 228331..228404 | + | |
| XV | YNCO0006W | SNR81 | snR81 | snoRNA gene | 234346..234546 | + |
| XV | YNCO0007W | SNR50 | snR50 | snoRNA gene | 259489..259578 | + |
| XV | YNCO0008W | tS(GCU)O, tRNA-Ser | tRNA gene | 274673..274773 | + | |
| XV | YNCO0009W | SUF17 | tG(GCC)O2, tRNA-Gly | tRNA gene | 282164..282234 | + |
| XV | YNCO0010W | SUP3 | tY(GUA)O, tRNA-Tyr | tRNA gene | 288192..288280 | + |
| XV | YNCO0011W | tP(UGG)O1, tRNA-Pro | tRNA gene | 301097..301198 | + | |
| XV | YNCO0012C | tR(ACG)O, tRNA-ARg | tRNA gene | 340299..340371 | – | |
| XV | YNCO0013C | tT(AGU)O2, tRNA-Thr | tRNA gene | 354041..354113 | – | |
| XV | YNCO0014C | SNR9 | snR9 | snoRNA gene | 407948..408134 | – |
| XV | YNCO0015C | SNR62 | snR62 | snoRNA gene | 409765..409864 | – |
| XV | YNCO0016W | tK(UUU)O, tRNA-Lys | tRNA gene | 438643..438738 | + | |
| XV | YNCO0017W | SUF11 | tP(UGG)O2, tRNA-Pro | tRNA gene | 464450..464551 | + |
| XV | YNCO0018W | tN(GUU)O2, tRNA-Asn | tRNA gene | 487439..487512 | + | |
| XV | YNCO0019W | tD(GUC)O, tRNA-Asp | tRNA gene | 571958..572029 | + | |
| XV | YNCO0020C | SUF5 | tG(CCC)O | tRNA gene | 594354..594425 | – |
| XV | YNCO0021C | tV(AAC)O | tRNA gene | 663812..663885 | – | |
| XV | YNCO0022C | SNR36 | snR36 | snoRNA gene | 680685..680866 | – |
| XV | YNCO0023W | IMT1 | tM(CAU)O1, tRNA-Met | tRNA gene | 710201..710272 | + |
| XV | YNCO0024C | SNR35 | snR35 | snoRNA gene | 759326..759529 | – |
| XV | YNCO0025W | SNR17A | snR17a | snoRNA gene | 780107..780596 | + |
| XV | YNCO0026W | SNR8 | snR8 | snoRNA gene | 832332..832521 | + |
| XV | YNCO0027C | SNR31 | snR31 | snoRNA gene | 841958..842182 | – |
| XV | YNCO0028W | SNR5 | snR5 | snoRNA gene | 842403..842606 | + |
| XV | YNCO0029C | tA(UGC)O, tRNA-Ala | tRNA gene | 854187..854259 | – | |
| XV | YNCO0030W | EMT2 | tM(CAU)O2, tRNA-Met | tRNA gene | 976421..976493 | + |
| XV | YNCO0031W | tP(UGG)O3, tRNA-Pro | tRNA gene | 980683..980787 | + | |
| XVI | YNCP0001C | tW(CCA)P, tRNA-Trp | tRNA gene | 56169..56274 | – | |
| XVI | YNCP0002W | GAL4 lncRNA | ncRNA gene | 79562..82648 | + | |
| XVI | YNCP0003W | SNR59 | snR59 | snoRNA gene | 173827..173904 | + |
| XVI | YNCP0004C | tE(UUC)P, tRNA-Glu | tRNA gene | 210192..210263 | – | |
| XVI | YNCP0005C | SNR17B | snR17b | snoRNA gene | 281056..281517 | – |
| XVI | YNCP0006C | IMT2 | tM(CAU)P, tRNA-Met | tRNA gene | 338848..338919 | – |
| XVI | YNCP0007C | tC(GCA)P1, tRNA-Cys | tRNA gene | 435893..435964 | – | |
| XVI | YNCP0008C | tF(GAA)P1, tRNA-Phe | tRNA gene | 560198..560289 | – | |
| XVI | YNCP0009W | tG(GCC)P1, tRNA-Gly | tRNA gene | 572269..572339 | + | |
| XVI | YNCP0010W | tK(CUU)P, tRNA-Lys | tRNA gene | 582062..582134 | + | |
| XVI | YNCP0011C | tF(GAA)P2, tRNA-Phe | tRNA gene | 622540..622631 | – | |
| XVI | YNCP0012W | SUP16 | tS(UGA)P, tRNA-Ser | tRNA gene | 689565..689646 | + |
| XVI | YNCP0013C | SNR51 | snR51 | snoRNA gene | 718700..718806 | – |
| XVI | YNCP0014C | SNR70 | snR70 | snoRNA gene | 718887..719050 | – |
| XVI | YNCP0015C | SNR41 | snR41 | snoRNA gene | 719148..719242 | – |
| XVI | YNCP0016W | tT(UGU)P, tRNA-Thr | tRNA gene | 744284..744355 | + | |
| XVI | YNCP0017C | tK(UUU)P, tRNA-Lys | tRNA gene | 769207..769302 | – | |
| XVI | YNCP0018C | tC(GCA)P2, tRNA-Cys | tRNA gene | 775765..775836 | – | |
| XVI | YNCP0019W | tN(GUU)P, tRNA-Asn | tRNA gene | 810676..810749 | + | |
| XVI | YNCP0020W | tI(AAU)P1, tRNA-Ile | tRNA gene | 819529..819602 | + | |
| XVI | YNCP0021W | SNR45 | snR45 | snoRNA gene | 821732..821903 | + |
| XVI | YNCP0022W | tA(AGC)P, tRNA-Ala | tRNA gene | 856902..856974 | + | |
| XVI | YNCP0023W | tG(GCC)P2, tRNA-Gly | tRNA gene | 860379..860449 | + | |
| XVI | YNCP0024C | tI(AAU)P2, tRNA-Ile | tRNA gene | 880296..880369 | – | |
| Mito | YNCQ0001W | tP(UGG)Q, tRNA-Pro | tRNA gene | 731..802 | + | |
| Mito | YNCQ0002W | 15S_RRNA | Q0020 | rRNA gene | 6546..8194 | + |
| Mito | YNCQ0003W | tW(UCA)Q, tRNA-Trp | tRNA gene | 9374..9447 | + | |
| Mito | YNCQ0004W | tE(UUC)Q, tRNA-Glu | tRNA gene | 35373..35444 | + | |
| Mito | YNCQ0005W | tS(UGA)Q2, tRNA-Ser | tRNA gene | 48201..48290 | + | |
| Mito | YNCQ0006W | 21S_RRNA | Q0158 | rRNA gene | 58009..62447 | + |
| Mito | YNCQ0007W | tT(UGU)Q1, tRNA-Thr | tRNA gene | 63862..63937 | + | |
| Mito | YNCQ0008W | tC(GCA)Q, tRNA-Cys | tRNA gene | 64415..64490 | + | |
| Mito | YNCQ0009W | tH(GUG)Q, tRNA-His | tRNA gene | 64596..64670 | + | |
| Mito | YNCQ0010W | tL(UAA)Q, tRNA-Leu | tRNA gene | 66095..66179 | + | |
| Mito | YNCQ0011W | tQ(UUG)Q, tRNA-Gln | tRNA gene | 66210..66285 | + | |
| Mito | YNCQ0012W | tK(UUU)Q, tRNA-Lys | tRNA gene | 67061..67134 | + | |
| Mito | YNCQ0013W | tR(UCU)Q1, tRNA-Arg | tRNA gene | 67309..67381 | + | |
| Mito | YNCQ0014W | tG(UCC)Q, tRNA-Gly | tRNA gene | 67468..67542 | + | |
| Mito | YNCQ0015W | tD(GUC)Q, tRNA-Asp | tRNA gene | 68322..68396 | + | |
| Mito | YNCQ0016W | tS(GCU)Q1, tRNA-Ser | tRNA gene | 69203..69288 | + | |
| Mito | YNCQ0017W | tR(ACG)Q2, tRNA-Arg | tRNA gene | 69289..69362 | + | |
| Mito | YNCQ0018W | tA(UGC)Q, tRNA-Ala | tRNA gene | 69846..69921 | + | |
| Mito | YNCQ0019W | tI(GAU)Q, tRNA-Ile | tRNA gene | 70162..70237 | + | |
| Mito | YNCQ0020W | tY(GUA)Q, tRNA-Tyr | tRNA gene | 70824..70907 | + | |
| Mito | YNCQ0021W | tN(GUU)Q, tRNA-Asn | tRNA gene | 71433..71503 | + | |
| Mito | YNCQ0022W | tM(CAU)Q1, tRNA-Met | tRNA gene | 72630..72705 | + | |
| Mito | YNCQ0023W | tF(GAA)Q, tRNA-Phe | tRNA gene | 77431..77505 | + | |
| Mito | YNCQ0024C | tT(UAG)Q2, tRNA-Thr | tRNA gene | 78089..78162 | – | |
| Mito | YNCQ0025W | tV(UAC)Q, tRNA-Val | tRNA gene | 78533..78608 | + | |
| Mito | YNCQ0026W | tM(CAU)Q2, tRNA-Met | tRNA gene | 85035..85112 | + | |
| Mito | YNCQ0027W | RPM1 | Q0285 | ncRNA gene | 85295..85777 | + |
Various sequence and annotation files are available on SGD’s Downloads site.
Categories: Data updates